99
|
ATCC
hela atcc ccl 2 oligonucleotides sirna targeting setd8 mrna aaucgccuaggaagacugauc Hela Atcc Ccl 2 Oligonucleotides Sirna Targeting Setd8 Mrna Aaucgccuaggaagacugauc, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/hela atcc ccl 2 oligonucleotides sirna targeting setd8 mrna aaucgccuaggaagacugauc/product/ATCC Average 99 stars, based on 1 article reviews
hela atcc ccl 2 oligonucleotides sirna targeting setd8 mrna aaucgccuaggaagacugauc - by Bioz Stars,
2026-03
99/100 stars
|
Buy from Supplier |
94
|
Thermo Fisher
gene exp taf1 mm01229177 m1 Gene Exp Taf1 Mm01229177 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/gene exp taf1 mm01229177 m1/product/Thermo Fisher Average 94 stars, based on 1 article reviews
gene exp taf1 mm01229177 m1 - by Bioz Stars,
2026-03
94/100 stars
|
Buy from Supplier |
99
|
Thermo Fisher
biotinylated membrane protein Biotinylated Membrane Protein, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/biotinylated membrane protein/product/Thermo Fisher Average 99 stars, based on 1 article reviews
biotinylated membrane protein - by Bioz Stars,
2026-03
99/100 stars
|
Buy from Supplier |
96
|
MedChemExpress
sigma i2643 632 Sigma I2643 632, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/sigma i2643 632/product/MedChemExpress Average 96 stars, based on 1 article reviews
sigma i2643 632 - by Bioz Stars,
2026-03
96/100 stars
|
Buy from Supplier |
96
|
Sino Biological
research cell line source s authentication anti sars cov 2 spike antibody Research Cell Line Source S Authentication Anti Sars Cov 2 Spike Antibody, supplied by Sino Biological, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/research cell line source s authentication anti sars cov 2 spike antibody/product/Sino Biological Average 96 stars, based on 1 article reviews
research cell line source s authentication anti sars cov 2 spike antibody - by Bioz Stars,
2026-03
96/100 stars
|
Buy from Supplier |
88
|
Alomone Labs
coimmunoprecipitation Coimmunoprecipitation, supplied by Alomone Labs, used in various techniques. Bioz Stars score: 88/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/coimmunoprecipitation/product/Alomone Labs Average 88 stars, based on 1 article reviews
coimmunoprecipitation - by Bioz Stars,
2026-03
88/100 stars
|
Buy from Supplier |
90
|
Millipore
milliplex human cd8 t-cell panel Milliplex Human Cd8 T Cell Panel, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/milliplex human cd8 t-cell panel/product/Millipore Average 90 stars, based on 1 article reviews
milliplex human cd8 t-cell panel - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
97
|
Miltenyi Biotec
magnetic cd326 ep cam microbeads Magnetic Cd326 Ep Cam Microbeads, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/magnetic cd326 ep cam microbeads/product/Miltenyi Biotec Average 97 stars, based on 1 article reviews
magnetic cd326 ep cam microbeads - by Bioz Stars,
2026-03
97/100 stars
|
Buy from Supplier |
96
|
Cell Signaling Technology Inc
traf6 Traf6, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/traf6/product/Cell Signaling Technology Inc Average 96 stars, based on 1 article reviews
traf6 - by Bioz Stars,
2026-03
96/100 stars
|
Buy from Supplier |
94
|
OriGene
27mer sirna  27mer Sirna, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/27mer sirna/product/OriGene Average 94 stars, based on 1 article reviews
27mer sirna - by Bioz Stars,
2026-03
94/100 stars
|
Buy from Supplier |
90
|
CellSearch inc
epithelial cell adhesion molecule (epcam) magnetic beads Epithelial Cell Adhesion Molecule (Epcam) Magnetic Beads, supplied by CellSearch inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/epithelial cell adhesion molecule (epcam) magnetic beads/product/CellSearch inc Average 90 stars, based on 1 article reviews
epithelial cell adhesion molecule (epcam) magnetic beads - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
99
|
Miltenyi Biotec
hematopoietic progenitor magnetic associated cell sorting kit Hematopoietic Progenitor Magnetic Associated Cell Sorting Kit, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/hematopoietic progenitor magnetic associated cell sorting kit/product/Miltenyi Biotec Average 99 stars, based on 1 article reviews
hematopoietic progenitor magnetic associated cell sorting kit - by Bioz Stars,
2026-03
99/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Molecular Neurodegeneration
Article Title: VCP regulates early tau seed amplification via specific cofactors
doi: 10.1186/s13024-024-00783-z
Figure Lengend Snippet: List of Reagents
Article Snippet: NGLY1 (Human)—3 unique
Techniques: Protease Inhibitor, Cell Culture, Transfection, Magnetic Beads, Sequencing, Modification